About   Help   FAQ
Thbs1-pG, Thbs1-pH Primer Detail
Primers
  • Name
    Thbs1-pG, Thbs1-pH
  • Primer 1 Sequence
    TCCCCTATTCTGGAGGGTTC
  • Primer 2 Sequence
    GCCTTTCCACACACTGGTTT
  • ID
    MGI:5312205
Genes
Thbs1 thrombospondin 1
Expression
  • Assay Results
    2
References
J:96883 Olson LE, et al., Barx2 functions through distinct corepressor classes to regulate hair follicle remodeling. Proc Natl Acad Sci U S A. 2005 Mar 8;102(10):3708-13

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory