About   Help   FAQ
MH3338 probe 2940 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MH3338 probe 2940
  • Sequence Type
    cDNA
  • ID
    MGI:5309532
  • Note
    This probe was generated via PCR using primers MGI:5307426. Template sequence provided by GenePaint:
    GCTTTGGCACAGGCTTCTACTTGACCTTAGTTCGCAAGATGAAAAACATCCAGAGCCAAA
    GAGGTGGCTGTGAGGGGGTCTGCAGCTGTACATCAAAGGGTTTCTCTACCAGGTGTCCAA
    CCCGAGTCGATGAGATAACAGAAGAACAAGTCCTGGATGGAGATGTGCAGGAGCTGATGG
    ATTTGGTATACCACCATGTCCCAGAGGCAAAGCTGGTGGAATGCATTGGTCAAGAACTTA
    TCTTCCTCCTTCCAAACAAGAATTTCAAGCAGAGAGCATATGCCAGCCTTTTCCGAGAGC
    TGGAGGAGACTCTGGCTGACCTGGGGCTCAGCAGCTTTGGAATTTCTGACACTCCCCTGG
    AAGAGATTTTCCTGAAGGTCACAGAGGATGCTGGAGCGGGCTCTATGTTTGTAGGTGGCG
    CTCAGCAGAAAAGAGAACAAGCCGGTCTCCGGCACCCTTGTTCGGCTCCCACTGAGAAGC
    TCAGGCAGTATGCCCAGGCCCCACATACCTGTTCCCCAGGACAAGTGGATCCTCCCAAGG
    GCCAACCTTCCCCAGAGCCAGAGGACCCCGGTGTCCCATTCAACACAGGTGCTCGGCTGA
    TTCTTCAACATGTGCAGGCCCTGCTAGTCAAGCGATTCCATCACACCATCCGCAGCCGCA
    AGGACTTTGTGGCTCAGATTGTTCTCCCTGCCACTTTCGTGTTCTTGGCTCTGATGCTTT
    CAATCATTGTGCCTCCGTTTGGTGAATTTCCAGCTTTGACTCTTCATCCCTGGATGTATG
    GGCATCAATATACCTTCTTCAGCATGGACGAACCCAACAATGAACACCTTGAAGTACTGG
    CAGATGTCCTTCTGAACAGGCCAGGCTTTGGCAACCGTTGTCTAAAGGAAGAGTGGCTTC
    CGGAGTACCCATGCATTAATGCAACCTCCTGGAAGACGCCCTCCGTGTCCCCGAACATCA
    CCCACCTGTTCC
Source
  • Species
    mouse, laboratory
Genes
Abca4 ATP-binding cassette, sub-family A (ABC1), member 4
Expression
  • Assay Results
    94
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/15/2020
MGI 6.15
The Jackson Laboratory