About   Help   FAQ
Nedd4 cDNA4 Probe Detail
Nucleotide
Probe/Clone
  • Name
    Nedd4 cDNA4
  • Sequence Type
    cDNA
  • ID
    MGI:5306966
  • Note
    This cDNA was generated by PCR using primers: (GGATAAAATTAACCCTCACTAAAGGAGCCTGTGGGAGCTGTAAGA; GGATAATAATACGACTCACTATAGGATGAGTTCTGGGGACGACAC)
Source
  • Species
    mouse, laboratory
Genes
Nedd4 neural precursor cell expressed, developmentally down-regulated 4
Expression
  • Assay Results
    1
References
J:176460 Ayoub AE, et al., Transcriptional programs in transient embryonic zones of the cerebral cortex defined by high-resolution mRNA sequencing. Proc Natl Acad Sci U S A. 2011 Sep 6;108(36):14950-5

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory