About   Help   FAQ
Nedd4_F(QRT-PCR), Nedd4_R(QRT-PCR) Primer Detail
Primers
  • Name
    Nedd4_F(QRT-PCR), Nedd4_R(QRT-PCR)
  • Primer 1 Sequence
    ACGTGCTGTTCACTGCTGAT
  • Primer 2 Sequence
    TCACAACTCGTGTGTCATCG
  • ID
    MGI:5306942
Genes
Nedd4 neural precursor cell expressed, developmentally down-regulated 4
Expression
  • Assay Results
    4
References
J:176460 Ayoub AE, et al., Transcriptional programs in transient embryonic zones of the cerebral cortex defined by high-resolution mRNA sequencing. Proc Natl Acad Sci U S A. 2011 Sep 6;108(36):14950-5

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory