About   Help   FAQ
MH_QS9 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MH_QS9
  • Sequence Type
    cDNA
  • ID
    MGI:5299057
  • Note
    Probe was amplified by RT-PCR (see MGI:5298786 for primer sequences). Template sequence provided by GenePaint via GUDMAP:
    TACCACGTGTGCCTCTGAAGACACTGTGTGGATGATTTCATTGCATCTACGTTGTAGTTT
    AGGATGGTGTCTTGAATAAGACTTTAGTTGGCATTCAAGTCCACCAGTACAAAGATTATG
    CAGCTTATACATCACACATGAGACACTTGTTAATCAAAGTACTCTTTTGTAAGTTTTATG
    TCAATTTTTAAAACTCTAAGATAAACCATTTTCCATTTCTTTTTAAAAATTGAGTAGAAA
    GATTAATTTAAAATTCCTGGGACCATATTTATTTAGAAATAGCTGTTAGTAAATATTAGA
    CAAGGAGTCCGGACATAATATTTATCCAGATCTCTAAGCAGTTAGCTTTAAATTATACAG
    TAAAAATCTCTAAGAGTTGTCTCCTGGGAAGGCTTTCGTGGTAACCTGTCACAGCCCACC
    TTCCTGCACTTCTTCCCTGCCCTCAGGAATCACTCTACCTCAGGCTACAGACAGAGGGAT
    GGCCCTGACCTCAGGCCAGGTACCTTCCTTTCTGTGATGAGCAGTGATGGAGAGCCACGC
    CAGCAAGGTGGCTTTTACCCACGGGATGCGCTTCTCTGGCCTGCTTTTTCCATTTGAGTT
    TTAAGATTTGACAAAGCATTTCACCGAGAGAATTTGCATGTGATAGAAAAATAAATCTGT
    GATTTAAAAAAAAGAGACCAGACCCCCTCCCTAATTTGGGTTTTTCTTCCTTTCACCACC
    AAATGGTCCCAGTCTGACGAGGTGTGTGCCCGCCACATGCCCTGGTAGCCAAGAGGATGA
    GGATGGGCAGCAGCAGGAGCCAGCGTAGAGCCTGGGCCTCAGGCGCACAGCAGGAGGCCT
    GCTTCTCAAGTGCAGCCTCTGAGGAAGGGAGATTTAAACCCTGATCCCATCACAGTGTG
  • Synonyms
    GUDMAP:15357 probe, GUDMAP:15358 probe, maprobe:6469, MH2143 probe 1770
Source
  • Species
    mouse, laboratory
Genes
Slc2a12 solute carrier family 2 (facilitated glucose transporter), member 12
Expression
  • Assay Results
    28
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:177549 Willnow T, et al., The European renal genome project: an integrated approach towards understanding the genetics of kidney development and disease. Organogenesis. 2005 Apr;2(2):42-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory