About   Help   FAQ
MH_M173 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MH_M173
  • Sequence Type
    cDNA
  • ID
    MGI:5298942
  • Note
    Probe was amplified by RT-PCR (see MGI:5298693 for primer sequences). Template sequence provided by GenePaint via GUDMAP:
    ATACCAGCACTTTGAGGAGGAGAAAGGAGTGTGGACAAGAGTCTGAAGATTGGGCCTATA
    GGGAAGAGCCAGCCCAGCCTACAGCGCTGTCCCAGGACAGAGGTTCTTGGTACCTCCCGG
    TGCTCAGAGCAGACCCTAAAGGAAGCCAAGTCCTTCCTGAGACAGGCAGATCCAGGATGG
    GGAACCCAGGGGATCGAGTGTCACTGGGGGAGACCTGGAGCAGGGAAGTGCACCCTGACA
    TAGACAGTGAATGGCACTCCCCGTCCTTCAGTGTGGAGCGGCTCACCAACATCCTTGATG
    GAGGCATCCCAAACACTGAGCTGCGGAGAAGAGTTGAAAGCCTCATCCAACGTGACCCAG
    TGTTTAATTTGAAGCATCTTTACTTCATGACCCGAGATGAGCTATATGAGGATGCAGTTC
    AAAAGAGATTCCATCTTGAGAAGCTAGCCTGGAGCCTGGGCTGGTCAGAAGACGGTCCTG
    AACGCATTTATGCTGACAGAGTCCTTGCTGGATATAACAACTTAAACTTACATGGTATTG
    CCATGAATGCTATCAGAAGCCTGGGCTCAGATGAGCAGATTGCTAAATGGGGCCAACTCG
    GCAAAAACTTCCAAATCATCACAACATATGCCCAGACAGAGCTGGGACATGGGACATACC
    TGCAGGGCCTGGAGACCGAAGCAACCTATGATGCAACCACCCAGGAGTTTGTGATACACA
    GCCCTACAATGACTTCCATCAAGTGGTGGCCTGGGGACTTGGGACGGACAGTCACCCATG
    CTGTGGTCCTAGCCCATTTGATCTGCTTAGGAGCCCGGCATGGCATGCATGCCTTCATTG
    TGCCCATCCGGAGCCTAGAGGACCACACCCCACTGCCAGGAATAACAGTTGGGGACATAG
    GCCCCAAGATGGGCTTCGAAAACATAGACAATGGCTTCCTGCGACTGAACCACGTGAGGG
    TT
  • Synonyms
    GUDMAP:15266 probe, GUDMAP:15725 probe, maprobe:7557, MH2599 probe 2225
Source
  • Species
    mouse, laboratory
Genes
Acox2 acyl-Coenzyme A oxidase 2, branched chain
Expression
  • Assay Results
    43
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:177549 Willnow T, et al., The European renal genome project: an integrated approach towards understanding the genetics of kidney development and disease. Organogenesis. 2005 Apr;2(2):42-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/12/2022
MGI 6.17
The Jackson Laboratory