About   Help   FAQ
2C11H-pA, 2C11H-pB Primer Detail
Primers
  • Name
    2C11H-pA, 2C11H-pB
  • Primer 1 Sequence
    GTTTGATTTTATTGACGATCTGG
  • Primer 2 Sequence
    AGGAGCAAAGGGCCACGG
  • ID
    MGI:5006819
Genes
Erh ERH mRNA splicing and mitosis factor
Expression
  • Assay Results
    5
References
J:16710 Temeles GL, et al., Expression patterns of novel genes during mouse preimplantation embryogenesis. Mol Reprod Dev. 1994 Feb;37(2):121-9

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/21/2020
MGI 6.14
The Jackson Laboratory