About   Help   FAQ
RIKEN clone D930008C07 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone D930008C07 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:5002187
  • Region Covered
    nucleotides 1528 - 2228 of AK086146.1
  • Parent Clone
  • Insert Size
    0.700kb
  • Note
    This probe was generated via PCR using the following primer set: GTCATCTGACCCGCCCACCC and TAATACGACTCACTATAGGGTGCACCTGCTGAACTCAG. These primers were designed to the coding region. A T7 promoter sequence was added to the reverse primer for probe transcription.
  • Synonyms
    GUDMAP:10204 probe, GUDMAP:10224 probe, maprobe:5144
Source
  • Library
    Riken mouse cDNA library D9-300 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    embryonic day 15.0
  • Tissue
    head
Genes
Maml1 mastermind like transcriptional coactivator 1
Expression
  • Assay Results
    24
Sequences
AK086146 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory