About   Help   FAQ
RIKEN clone 2900003L19 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone 2900003L19 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:5002036
  • Region Covered
    nucleotides 10 - 457 of AK019303
  • Parent Clone
  • Insert Size
    0.447kb
  • Note
    This probe was generated via PCR using the following primer set: CAATGCTGTTCTTATCCTCCGAGGG and TAATACGACTCACTATAGGGGGTACCTACTTTATTGTTTT. These primers were designed to the coding region. A T7 promoter sequence was added to the reverse primer for probe transcription.
  • Synonyms
    GUDMAP:8513 probe, GUDMAP:8687 probe, maprobe:4604
Source
  • Library
    Riken mouse cDNA library 29-000 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal adult
  • Sex
    Male
  • Tissue
    hippocampus
Genes
Gpr37l1 G protein-coupled receptor 37-like 1
Expression
  • Assay Results
    24
Sequences
AK019303 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/03/2022
MGI 6.21
The Jackson Laboratory