About   Help   FAQ
RIKEN clone 6030465L19 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone 6030465L19 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:5001122
  • Region Covered
    nucleotides 104 - 671 of AK031640.1
  • Parent Clone
  • Insert Size
    0.567kb
  • Note
    This probe was generated via PCR using the following primer set: GCCTTTGTTCCACAACCCTA and CGATGTTAATACGACTCACTATAGGGCCAAGGACCTCAGCTGCTAC.
  • Synonyms
    GUDMAP:7844 probe, GUDMAP:7845 probe, GUDMAP:7846 probe, GUDMAP:7847 probe, GUDMAP:7848 probe, maprobe:4323
Source
  • Library
    Riken mouse cDNA library 60-304 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    embryonic day 13.0
  • Sex
    Male
  • Tissue
    testis
Genes
Gtf2f2 general transcription factor IIF, polypeptide 2
Expression
  • Assay Results
    16
Sequences
AK031640 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory