About   Help   FAQ
RIKEN clone 4932409F03 subclone 1 Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone 4932409F03 subclone 1
  • Sequence Type
    cDNA
  • ID
    MGI:5001013
  • Region Covered
    3' untranslated region of gene (nucleotides 245 - 845 of AK029943.1)
  • Parent Clone
  • Insert Size
    0.600kb
  • Note
    This probe was generated via PCR using the following primer set: GCTCTTGCAGCTATTGGACC and CGATGTTAATACGACTCACTATAGGGAGACAGGCTCAGCACAGGAT. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
  • Synonyms
    GUDMAP:13587 probe, maprobe:6048
Source
  • Library
    Riken mouse cDNA library 49-324 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal adult
  • Sex
    Male
  • Tissue
    testis
Genes
Taf4b TATA-box binding protein associated factor 4b
Expression
  • Assay Results
    8
Sequences
AK029943 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory