About   Help   FAQ
UI-M-AH0-act-d-09-0-UI Probe Detail
Nucleotide
Probe/Clone
  • Name
    UI-M-AH0-act-d-09-0-UI
  • Sequence Type
    cDNA
  • ID
    MGI:5000850
  • Note
    This probe template was generated via T3 and T7 primers to amplify the clone insert: AATTAACCCTCACTAAAGGG and TAATACGACTCACTATAGGG.
  • Synonyms
    GUDMAP:9622 probe, maprobe:4873
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL/6
  • Tissue
    brain
Genes
Chst2 carbohydrate sulfotransferase 2
Expression
  • Assay Results
    13
Sequences
AI840257 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:133949 Valerius MT, et al., Transcriptional profiling of Wnt4 mutant mouse kidneys identifies genes expressed during nephron formation. Gene Expr Patterns. 2008 May;8(5):297-306

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory