About   Help   FAQ
msy2-pC, msy2-pD Primer Detail
Primers
  • Name
    msy2-pC, msy2-pD
  • Primer 1 Sequence
    CCACCACCCTTCTTCTATCGA
  • Primer 2 Sequence
    GGTGATGCCTCGGAACAATA
  • ID
    MGI:4948904
Genes
Ybx2 Y box protein 2
References
J:71954 Yu J, et al., Expression of msy2 in mouse oocytes and preimplantation embryos. Biol Reprod. 2001 Oct;65(4):1260-70

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory