About   Help   FAQ
Pdpk1-pA, Pdpk1p-B Primer Detail
Primers
  • Name
    Pdpk1-pA, Pdpk1p-B
  • Primer 1 Sequence
    TTCTTGGCGAGGGCTCTTT
  • Primer 2 Sequence
    CATATTCTCTGGAAGTGGCCAGTT
  • ID
    MGI:4944080
Genes
Pdpk1 3-phosphoinositide dependent protein kinase 1
Expression
  • Assay Results
    2
References
J:168170 Inoue T, et al., APOA-1 is a Novel Marker of Erythroid Cell Maturation from Hematopoietic Stem Cells in Mice and Humans. Stem Cell Rev. 2011 Mar;7(1):43-52

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory