About   Help   FAQ
RIKEN clone C330009H20 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone C330009H20 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:4845937
  • Region Covered
    Probe sequence spans from 388 to 1083 of AK082763.1
  • Parent Clone
  • Insert Size
    .695kb
  • Note
    This probe was generated by PCR using the following primer set: CACTGCTGTGCCTGTTTGTC and CGATGTTAATACGACTCACTATAGGGGTAGCCATACCGCCCTGATA. The reverse primer is linked to a T7 polymerase promoter tag.
  • Synonyms
    GUDMAP:9856 probe, GUDMAP:9857 probe, GUDMAP:9858 probe, GUDMAP:9859 probe, GUDMAP:10001 probe, maprobe:4934
Source
  • Library
    Riken mouse cDNA library C3-300 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Tissue Description
    ES cells
Genes
Cd2ap CD2-associated protein
Expression
  • Assay Results
    37
Sequences
AK082763 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:148410 Combes AN, et al., Three-dimensional visualization of testis cord morphogenesis, a novel tubulogenic mechanism in development. Dev Dyn. 2009 May;238(5):1033-41

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory