About   Help   FAQ
Supt5h cDNA Probe Detail
Nucleotide
Probe/Clone
  • Name
    Supt5h cDNA
  • Sequence Type
    cDNA
  • ID
    MGI:4844619
  • Note
    This probe was generated by PCR using the following primer set: GTAATACGACTCACTATAGGGATGTATGGCTCCCAGACACC and CATTTAGGTGACACTATAGTGCTGACCACCTTCTCACTG. These primers contain promoter sequence.
Source
  • Species
    mouse, laboratory
Genes
Supt5 suppressor of Ty 5, DSIF elongation factor subunit
Expression
  • Assay Results
    2
References
J:156017 Yokoyama S, et al., A systems approach reveals that the myogenesis genome network is regulated by the transcriptional repressor RP58. Dev Cell. 2009 Dec;17(6):836-48

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/12/2022
MGI 6.17
The Jackson Laboratory