About   Help   FAQ
Trpc4-pG, Trpc4-pH Primer Detail
Primers
  • Name
    Trpc4-pG, Trpc4-pH
  • Primer 1 Sequence
    CGCAGCATTCCTGGTCTCAATGAA
  • Primer 2 Sequence
    ACTTGAAGGTGGAGCACACTCTCT
  • ID
    MGI:4821972
Genes
Trpc4 transient receptor potential cation channel, subfamily C, member 4
Expression
  • Assay Results
    7
References
J:161879 Asai Y, et al., A quantitative analysis of the spatiotemporal pattern of transient receptor potential gene expression in the developing mouse cochlea. J Assoc Res Otolaryngol. 2010 Mar;11(1):27-37

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/10/2019
MGI 6.14
The Jackson Laboratory