About   Help   FAQ
Inka1-F, Inka1-G Primer Detail
Primers
  • Name
    Inka1-F, Inka1-G
  • Primer 1 Sequence
    GCATGCTCTAGACTGGGAC
  • Primer 2 Sequence
    CGAGCCCTGGCCAGCCTACG
  • ID
    MGI:4456453
  • Region Covered
    exon 2
Genes
Inka1 inka box actin regulator 1
Expression
  • Assay Results
    4
References
J:157985 Reid BS, et al., Generation and characterization of a novel neural crest marker allele, Inka1-LacZ, reveals a role for Inka1 in mouse neural tube closure. Dev Dyn. 2010 Feb 19;239(4):1188-1196

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory