About   Help   FAQ
Dlx2-pI, Dlx2-pJ Primer Detail
Primers
  • Name
    Dlx2-pI, Dlx2-pJ
  • Primer 1 Sequence
    ACACCGCCGCGTACACCTCCTA
  • Primer 2 Sequence
    CTCGCCGCTTTTCCACATCTTC
  • ID
    MGI:4453041
Genes
Dlx2 distal-less homeobox 2
Expression
  • Assay Results
    1
References
J:157698 Ideguchi M, et al., Murine embryonic stem cell-derived pyramidal neurons integrate into the cerebral cortex and appropriately project axons to subcortical targets. J Neurosci. 2010 Jan 20;30(3):894-904

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory