About   Help   FAQ
Ophn1-pA, Ophn1-pB Primer Detail
Primers
  • Name
    Ophn1-pA, Ophn1-pB
  • Primer 1 Sequence
    CGTGATCAAAGACGGCAGCGCGCTT
  • Primer 2 Sequence
    CCAAGGGTTTAATCAGCAAATCACTAGCA
  • ID
    MGI:4430345
Genes
Ophn1 oligophrenin 1
Expression
  • Assay Results
    6
References
J:85384 Fauchereau F, et al., The RhoGAP activity of OPHN1, a new F-actin-binding protein, is negatively controlled by its amino-terminal domain. Mol Cell Neurosci. 2003 Aug;23(4):574-86

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory