About   Help   FAQ
T39171 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T39171
  • Sequence Type
    cDNA
  • ID
    MGI:4425893
  • Note
    This probe was generated by PCR using the following primer set: TTGCCTGTGTGGACATTCAT and GCGATTTAGGTGACACTATAGGCCCCTTTCACCTCCTTATTC. These primers contain adaptor sequence. Template sequence provided by Eurexpress:
    TTGCCTGTGTGGACATTCATGCCAATGAGGTCCAACTCTTTGTAGCCTCATTGGTCTTGC
    TGCTCCTACCCTTAGCCCTGATACTGACGTCCTATGGACATATAGCTAAGGCAGTTATAA
    GAATCAAGTCATCCCAGGCTTGGCGTAGAGCCCTGGGCACATGTGGATCCCACTTGATGG
    TTGTGTCTCTCTTTTATGGGAGCATCACAGCCATCTACATCCAGCCGAACAGTTCATATG
    CCCACACCCATGGGAAGTTCATCTCTCTCTTTTACACTGTTATGACCCCGACCCTTAATC
    CCCTCATCTACACACTGAGGAATAAGGAGGTGAAAGGGGCTCTCGGACGGCTCTTCAATA
  • Synonyms
    ES2498 probe 2399
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal
  • Tissue
    brain
Genes
Or2g1 olfactory receptor family 2 subfamily G member 1
Expression
  • Assay Results
    3
References
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/09/2022
MGI 6.21
The Jackson Laboratory