About   Help   FAQ
T37689 Probe Detail
  • Name
  • Sequence Type
  • ID
  • Note
    This probe was generated by PCR using the following primer set: CACATACCCAACTGACCTCTCA and GCGATTTAGGTGACACTATAGGATTCCTTTTCATGAGCACAG. These primers contain adaptor sequence. Template sequence provided by Eurexpress:
  • Synonyms
    EN1537 probe 1419
  • Species
    mouse, laboratory
  • Strain
  • Age
  • Tissue
Dmxl2 Dmx-like 2
  • Assay Results
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.17
The Jackson Laboratory