About   Help   FAQ
T35662 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T35662
  • Sequence Type
    cDNA
  • ID
    MGI:4422805
  • Note
    This probe was generated by PCR using the following primer set: GGTTTTGGAGAAATCAGACCAG and GCGATTTAGGTGACACTATAGATTCATATAACTCTGCTAGGCCC. These primers contain adaptor sequence. Template sequence provided by Eurexpress:
    GGTTTTGGAGAAATCAGACCAGACCAATATCCTCAGTGCCCTGCTTGTTTTACTTCAGGA
    CAGCCTGCTAGCAACAGCTAGTTCTCCCAAATTCTCAGAGCTTGTTATGAAGTGTCTATG
    GAGAATGGTTCGACTATTACCTGACACCATCAACAGCATTAACCTAGACAGAATTCTTCT
    GGACATCCACATTTTCATGAAGGTCTTTCCCAAAGAGAAATTGAAGCAATGCAAAAGTGA
    ATTTCCTATAAGGACTCTAAAGACCCTTCTACATACTTTATGCAAATTAAAAGGACCTAA
    AATCCTAGACCACCTTACAATGATTGATAATAAGAATGAGTCAGAATTGGAGGCCCACCT
    GTGTCGGATGATGAAGCATAGTATGGACCAGACTGGGAGCAAGTCTGATAAGGAAACAGA
    AAAGGGAGCTTCTCGAATAGATGAAAAATCATCAAAGGCCAAAGTAAATGATTTCTTAGC
    TGAGATTTTTAAGAAGATTGGCTCCAAAGAGAACACTAAGGAGGGCCTAGCAGAGTTATA
    TGAATATAAGAAGAAATATTCAGATACTGACATTGAACCATTTCTGAAAAATTCCTCGCA
    GTTCTTTCAGA
  • Synonyms
    EH3314 probe 3259, GUDMAP:14828 probe, GUDMAP:14829 probe, maprobe:6966
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal
  • Tissue
    brain
Genes
Ckap5 cytoskeleton associated protein 5
Expression
  • Assay Results
    202
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:177549 Willnow T, et al., The European renal genome project: an integrated approach towards understanding the genetics of kidney development and disease. Organogenesis. 2005 Apr;2(2):42-7
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory