About   Help   FAQ
T35485 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T35485
  • Sequence Type
    cDNA
  • ID
    MGI:4422650
  • Note
    This probe was generated by PCR using the following primer set: AGCACTTCATAGGGAGAAGCAC and GCGATTTAGGTGACACTATAGCATACTGTGCTTCAGGTTCAACA. These primers contain adaptor sequence. Template sequence provided by Eurexpress:
    AGCACTTCATAGGGAGAAGCACTTATGACGAGGCTATTTTTAAACCGCGGTATTATCCTA
    ATTTAAAAGAAGATCGGTTTTTAATGATTTTTTATTTTCATAGGATGAAGTGAGAGAAAA
    TATTCAGCTGTCCACACAAAGTCTGGTTTCCCTGCCCAGCTTCCCCCTGGAAAGTGTACT
    TTTTGTTGTTCCATGTGTAGCTCGTTTGTGCCCATTGACATAAATGTTCCTTGGGTCTGC
    TCTTTATAGTAACTGAAAAAGAAGGTCACCCACTCCATTAGGCCACTGCCCTCCAGGGCC
    AAGGACTGAGGGTACAGAACCTTAGCACACCAGTGTCTCCTCCTCTTTGCTGTATTGCCC
    CCTCCCTCTGGATCAGCCCCAGAGTGGGAAGCAGCAGGCTCCGTTTCGCTCCCCTTTCTC
    TTTCTGAGTTAGCAACCAAGAAGCTGCAACTTGACATTCGCCATCACATCTGCCTCATCC
    ATCACCTCCTTTCCTTCTCTGCCCACCAAGTCCTTGTACCCGCAGAGAACCCACTGACCG
    CCTCCTGCCCTCTCGGGGCAGATTGTTGAACCTGAAGCACAGTATGACCACTCACGATCA
    AGCAGATCT
  • Synonyms
    EN1242 probe 1131
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal
  • Tissue
    brain
Genes
Kmt2a lysine (K)-specific methyltransferase 2A
Expression
  • Assay Results
    94
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/22/2020
MGI 6.16
The Jackson Laboratory