About   Help   FAQ
T31400 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T31400
  • Sequence Type
    cDNA
  • ID
    MGI:4416860
  • Parent Clone
  • Note
    This probe was generated by PCR using the following primer set: TTCTGGCCGCTTCTTCAC and GCGATTTAGGTGACACTATAGACGGGTGTGGGTCAGAAA. These primers contain adaptor sequence. Template sequence provided by Eurexpress:
    TTCTGGCCGCTTCTTCACTGACTATGGTTGTGACATTGAACATGGCAGCGTATGCACCTA
    CCACCCAGGGGCTGTGCACTGTGTGCGCTCTGTGCAAGCCAGCCCCAGGTATGGCTCAGG
    CCAGCAATGCTGCTACACGGCAGCAGGGACACAGCTCCTGACTTCAGACTCGACAAGTGG
    CAGCACCCCTGACCGTGGCCACGACTGGGGTGCACCCCCATACCGGACTCCTCCCCGTGT
    GCCCGGCATGTCTCATTGGCTCTATGACGTCATCAGCTTCTATTACTGCTGTCTTTGGGC
    TCCTGAGTGTCCCCGTTATATGAAGCGCCGGCCCTCCAGTGACTGCCGCAACTACAGACC
    CCCACGCCTGGCCTCTGCCTTCGGGGACCCCCATTTTGTCACCTTTGATGGCACCAGCTT
    CTCGTTCAGCGGCAATGGCGAATATGTGCTATTGGAGACCACCCTGAGTGATCTGAGAGT
    GCAGGGCCGGGCCCAGCCTGGGAGAATGCCCAATGGCACCCAGGCCCGTGGCACAGGGCT
    GACTGCAGTGGCCGTCCAAGAAGACAATTCGGATGTGATAGAGGTGCGGTTAGCTGGCGG
    GTCTCGGGTCTTGGAAGTGTTGCTGAATCAGAAAGTGCTCAGTTTCACTGAACAAAATTG
    GATGGACCTGAAGGGCATGTTCCTGTCAGTGGCCGCTCAGGATAAGGTGTCAATCATGTT
    GTCATCGGGGGCTGGCCTCGAGGTCGGTGTACAAGGTCCTTTCCTGAGTGTGAGCATTCT
    GTTGCCTGAGAAGTTTCTGACCCACACCCG
  • Synonyms
    ES2094 probe 2019
Source
  • Library
    NCI_CGAP_Kid14 (J:91912)
  • Species
    mouse, laboratory
  • Strain
    FVB/N
  • Age
    postnatal month 5
  • Sex
    Male
  • Tissue
    kidney
Genes
Susd2 sushi domain containing 2
Expression
  • Assay Results
    51
References
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory