About   Help   FAQ
T31349 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T31349
  • Sequence Type
    cDNA
  • ID
    MGI:4416826
  • Parent Clone
  • Note
    This probe was generated by PCR using the following primer set: CTCACTGGCCACTGGCTT and GCGATTTAGGTGACACTATAGCACGAGGAAGGAGGAGCA. These primers contain adaptor sequence. Template sequence provided by Eurexpress:
    CTCACTGGCCACTGGCTTCTCATGGATGCTCTGGCCATGGGTCTCTGTGTTGCCATGATC
    GCCTTCGTCCGCCTGCCAAGCCTCAAGGTTTCCTGCCTGCTTCTCTCAGGGCTTCTCATC
    TACGATGTCTTCTGGGTGTTCTTCTCAGCCTACATCTTCAACAGTAATGTCATGGTGAAA
    GTGGCCACACAGCCAGCTGACAATCCCCTCGACGTTCTGTCCAGGAAGCTCCACCTGGGA
    CCCAATGTGGGGCGTGATGTTCCTCGCCTGTCTTTGCCTGGAAAATTGGTCTTCCCAAGC
    TCCACTGGCAGTCACTTCTCTATGCTGGGCATCGGGGACATTGTGATGCCCGGCCTCCTG
    TTATGCTTTGTTCTTCGCTATGACAACTACAAGAAACAAGCCAGTGGTGACTCGTGTGGG
    GCCCCTGGCCCAGCCAATATCTCTGGGCGCATGCAGAAGGTCTCCTACTTCCACTGCACC
    CTCATCGGGTACTTTGTAGGTCTGCTCACTGCGACTGTGGCGTCTCGCATCCACCGAGCT
    GCCCAGCCAGCTCTCCTCTACTTGGTGCCATTTACCCTATTGCCACTCCTCACCATGGCC
    TACCTAAAGGGTGACTTACGGAGGATGTGGTCTGAGCCCTTCCACTCCAAGTCCAGCAGC
    TCCCGGTTCCTGGAAGTATGATGACGCGGGAGAGGTGACCAGAGCGCTGTCCTCACCTTC
    CTCTCTCACCGCGCGGTTTTGTTCCCTCTACAAGCTGGCCTGACTCAGGCATGCCTGCTC
    ACGGAACTGCAGTGTGACTGGAGTGTGTGTCTGAGGGGAGCGTTTGCAGAGGGCACTGGA
    GCCCTGCACAGCCCTTCTCTTCTCCGCTCTGGGAGAGTGGACCCTTCCAGAAGGGGCAGG
    CCGGCCCTTCGCCCGGTGCTCCTCCTTCCTCGT
  • Synonyms
    ES2061 probe 1972
Source
  • Library
    NCI_CGAP_Mam3 (J:91912)
  • Species
    mouse, laboratory
  • Age
    postnatal month 10
  • Sex
    Female
  • Tissue
    mammary gland tumor
Genes
Sppl3 signal peptide peptidase 3
Expression
  • Assay Results
    5
References
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/16/2021
MGI 6.17
The Jackson Laboratory