About   Help   FAQ
T50337-pA, T50337-pB Primer Detail
Primers
  • Name
    T50337-pA, T50337-pB
  • Primer 1 Sequence
    TCAGCTCTCCAGACATGTTG
  • Primer 2 Sequence
    AAGGGACTGGGAAGGCTTTA
  • ID
    MGI:4411646
Genes
Dusp7 dual specificity phosphatase 7
References
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory