About   Help   FAQ
T51124-pA, T51124-pB Primer Detail
Primers
  • Name
    T51124-pA, T51124-pB
  • Primer 1 Sequence
    GGGACCTTGTCCCTCCTAAG
  • Primer 2 Sequence
    TTCTTTCCTCGGTGAGATGC
  • ID
    MGI:4410992
Genes
Thy1 thymus cell antigen 1, theta
References
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory