About   Help   FAQ
Wnt3a-pK, Wnt3a-pL Primer Detail
Primers
  • Name
    Wnt3a-pK, Wnt3a-pL
  • Primer 1 Sequence
    GTGCACACCTGCAAGTAGGA
  • Primer 2 Sequence
    TCCAAAAGTTCCACCCAGTC
  • ID
    MGI:4367811
Genes
Wnt3a wingless-type MMTV integration site family, member 3A
References
J:146657 Witte F, et al., Comprehensive expression analysis of all Wnt genes and their major secreted antagonists during mouse limb development and cartilage differentiation. Gene Expr Patterns. 2009 Apr;9(4):215-23

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory