About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 7:30-8:30 AM EDT Thursday, May 28.
AF4-pA, AF4-pB Primer Detail
Primers
  • Name
    AF4-pA, AF4-pB
  • Primer 1 Sequence
    CCTGCTTCGAATCAGAGAGA
  • Primer 2 Sequence
    CA TCCTTAGTCTGGTGAGCT
  • ID
    MGI:4356472
Genes
Aff1 AF4/FMR2 family, member 1
References
J:100030 Urano A, et al., Infertility with defective spermiogenesis in mice lacking AF5q31, the target of chromosomal translocation in human infant leukemia. Mol Cell Biol. 2005 Aug;25(15):6834-45

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/19/2020
MGI 6.15
The Jackson Laboratory