About   Help   FAQ
Camta-pA, Camta-pB Primer Detail
Primers
  • Name
    Camta-pA, Camta-pB
  • Primer 1 Sequence
    GAACAGATCCAGCCACCATT
  • Primer 2 Sequence
    AGGGGTCTGCCCTTGTACTT
  • ID
    MGI:4355332
Genes
Camta1 calmodulin binding transcription activator 1
Expression
  • Assay Results
    7
References
J:150715 Malcuit C, et al., Identification of novel oocyte and granulosa cell markers. Gene Expr Patterns. 2009 Sep;9(6):404-10

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory