About   Help   FAQ
PP-2A alpha-pC, PP-2A alpha-pD Primer Detail
Primers
  • Name
    PP-2A alpha-pC, PP-2A alpha-pD
  • Primer 1 Sequence
    CATGAGGGTCCAATGTGTGACT
  • Primer 2 Sequence
    ACCACGGTCATCTGGATCTGA
  • ID
    MGI:4353189
Genes
Ppp2ca protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
Expression
  • Assay Results
    4
References
J:135212 Liu WB, et al., Differential expression of the catalytic subunits for PP-1 and PP-2A and the regulatory subunits for PP-2A in mouse eye. Mol Vis. 2008;14:762-73

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/08/2020
MGI 6.15
The Jackson Laboratory