About   Help   FAQ
Cd3d-pA, Cd3d-pB Primer Detail
Primers
  • Name
    Cd3d-pA, Cd3d-pB
  • Primer 1 Sequence
    AAGAAGTTTCCATGACATCATGAA
  • Primer 2 Sequence
    AGAAGAAAATTCTTGACAGCTCTG
  • ID
    MGI:414
Genes
Cd3d CD3 antigen, delta polypeptide
Polymorphisms
J:13215 Ma Q, et al., Proc Natl Acad Sci U S A. 1993 Jul 1;90(13):6350-4
Notes: Genomic DNA was amplified via PCR, subjected to electrophoresis on a 3% agarose gel and viewed using ethidium bromide.
Endonuclease Gene Allele Fragments Strains
Cd3d a 210.0bp AEJ/Gn
s 340.0bp M. spretus
References
J:13215 Ma Q, et al., Analysis of the murine All-1 gene reveals conserved domains with human ALL-1 and identifies a motif shared with DNA methyltransferases. Proc Natl Acad Sci U S A. 1993 Jul 1;90(13):6350-4

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/31/2020
MGI 6.15
The Jackson Laboratory