About   Help   FAQ
Caspr5-3 is2 Probe Detail
Nucleotide
Probe/Clone
  • Name
    Caspr5-3 is2
  • Sequence Type
    oligo
  • ID
    MGI:3851358
  • Region Covered
    ATATCTGCAGCCAGGAGGTGTCTGGAGGCAGGGATGCAGCAT, exon 9
Source
  • Species
    mouse, laboratory
Genes
Cntnap5c contactin associated protein-like 5C
Expression
  • Assay Results
    3
References
J:144618 Weichenhan D, et al., A mouse translocation associated with Caspr5-2 disruption and perinatal lethality. Mamm Genome. 2008 Dec;19(10-12):675-86

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory