About   Help   FAQ
MOR267-16-pA, MOR267-16-pB Primer Detail
Primers
  • Name
    MOR267-16-pA, MOR267-16-pB
  • Primer 1 Sequence
    TCTTCCTTTCTGTCCTGTCCT
  • Primer 2 Sequence
    TGGAAAACGCTTTGTACCTG
  • ID
    MGI:3847306
Genes
Olfr370 olfactory receptor 370
References
J:135227 Tian H, et al., Differential development of odorant receptor expression patterns in the olfactory epithelium: a quantitative analysis in the mouse septal organ. Dev Neurobiol. 2008 Mar;68(4):476-86

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory