About   Help   FAQ
FXII-pC, FXII-pD Primer Detail
Primers
  • Name
    FXII-pC, FXII-pD
  • Primer 1 Sequence
    GCCTCAGCTTCTCAAGTTCT
  • Primer 2 Sequence
    TGAACGTGAGGTGACAGGAT
  • ID
    MGI:3841644
Genes
F12 coagulation factor XII (Hageman factor)
Expression
  • Assay Results
    14
References
J:74089 Ong K, et al., Early embryonic expression of murine coagulation system components. Thromb Haemost. 2000 Dec;84(6):1023-30

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory