About   Help   FAQ
SALM5-pA, SALM5-pB Primer Detail
Primers
  • Name
    SALM5-pA, SALM5-pB
  • Primer 1 Sequence
    ACACCCCATGCTTTTGCTGATCTACG
  • Primer 2 Sequence
    GATTGGTGCTGTTTAGTAGGTGAGGG
  • ID
    MGI:3829759
Genes
Lrfn5 leucine rich repeat and fibronectin type III domain containing 5
References
J:143398 Homma S, et al., Expression pattern of LRR and Ig domain-containing protein (LRRIG protein) in the early mouse embryo. Gene Expr Patterns. 2009 Jan;9(1):1-26

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/19/2020
MGI 6.15
The Jackson Laboratory