About   Help   FAQ
G2E3-pA, G2E3-pB Primer Detail
Primers
  • Name
    G2E3-pA, G2E3-pB
  • Primer 1 Sequence
    CGTCCAATTCACTCGGTAGCGGACG
  • Primer 2 Sequence
    CCATCGTTGTTGCAGATTTACCA
  • ID
    MGI:3829417
  • Region Covered
    exon 15 and 16
Genes
G2e3 G2/M-phase specific E3 ubiquitin ligase
Expression
  • Assay Results
    4
References
J:139062 Brooks WS, et al., G2E3 is a dual function ubiquitin ligase required for early embryonic development. J Biol Chem. 2008 Aug 8;283(32):22304-15

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory