About   Help   FAQ
H2-T11-pA, H2-T11-pB Primer Detail
Primers
  • Name
    H2-T11-pA, H2-T11-pB
  • Primer 1 Sequence
    CGGTATTTCCACACCGTCGTA
  • Primer 2 Sequence
    TAGAGATATGCGAGGCTAAGTTG
  • ID
    MGI:3819004
Genes
H2-T-ps histocompatibility 2, T region locus, pseudogene
Expression
  • Assay Results
    24
References
J:136804 Ohtsuka M, et al., Major histocompatibility complex (Mhc) class Ib gene duplications, organization and expression patterns in mouse strain C57BL/6. BMC Genomics. 2008;9:178

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory