About   Help   FAQ
Lgi1 probe Probe Detail
Nucleotide
Probe/Clone
  • Name
    Lgi1 probe
  • Sequence Type
    oligo
  • ID
    MGI:3811539
  • Region Covered
    GCTGCAGCTCTTGTTATTTACGTCG, the junction of exon 2 and 3
Source
  • Species
    mouse, laboratory
Genes
Lgi1 leucine-rich repeat LGI family, member 1
References
J:138622 Ribeiro PA, et al., Expression profile of lgi1 gene in mouse brain during development. J Mol Neurosci. 2008 Jul;35(3):323-9

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory