About   Help   FAQ
Dlk1-pG, Dlk1-pH Primer Detail
Primers
  • Name
    Dlk1-pG, Dlk1-pH
  • Primer 1 Sequence
    TTACCGGGGTTCCTTAGAGC
  • Primer 2 Sequence
    TGCATTAATAGGGAGGAAGGG
  • ID
    MGI:3797270
Genes
Dlk1 delta like non-canonical Notch ligand 1
Expression
  • Assay Results
    41
References
J:108133 Sekita Y, et al., Aberrant regulation of imprinted gene expression in Gtl2lacZ mice. Cytogenet Genome Res. 2006;113(1-4):223-9
J:117917 Kamei Y, et al., Peg1/Mest in obese adipose tissue is expressed from the paternal allele in an isoform-specific manner. FEBS Lett. 2007 Jan 9;581(1):91-6
J:147577 Takahashi N, et al., Deletion of Gtl2, imprinted non-coding RNA, with its differentially methylated region induces lethal parent-origin-dependent defects in mice. Hum Mol Genet. 2009 May 15;18(10):1879-88

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory