About   Help   FAQ
A230098A12Rik-pA, A230098A12Rik-pB Primer Detail
Primers
  • Name
    A230098A12Rik-pA, A230098A12Rik-pB
  • Primer 1 Sequence
    TGGCGATTCTGATGGGGATG
  • Primer 2 Sequence
    TGGAGCAAAGGGAAAGGTGG
  • ID
    MGI:3790822
Genes
Prtg protogenin
References
J:125749 Hou J, et al., A systematic screen for genes expressed in definitive endoderm by Serial Analysis of Gene Expression (SAGE). BMC Dev Biol. 2007;7:92

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory