About   Help   FAQ
Zfpm2-pA, Zfpm2-pB Primer Detail
Primers
  • Name
    Zfpm2-pA, Zfpm2-pB
  • Primer 1 Sequence
    GATAATCAGGCTCCAATTGCAC
  • Primer 2 Sequence
    CGGCTACATACGAATGCAAAG
  • ID
    MGI:3784262
Genes
Zfpm2 zinc finger protein, multitype 2
Expression
  • Assay Results
    2
References
J:130227 Millien G, et al., Characterization of the mid-foregut transcriptome identifies genes regulated during lung bud induction. Gene Expr Patterns. 2008 Jan;8(2):124-39

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory