About   Help   FAQ
Tes-pE, Tes-pF Primer Detail
Primers
  • Name
    Tes-pE, Tes-pF
  • Primer 1 Sequence
    ACATGCAGATGCTGCCTAAG
  • Primer 2 Sequence
    TGGGTCTTCTTGGATTCTGC
  • ID
    MGI:3773246
  • Region Covered
    exon 4
Genes
Tes testin LIM domain protein
Expression
  • Assay Results
    6
References
J:125765 Crompton LA, et al., Early embryonic expression patterns of the mouse Flamingo and Prickle orthologues. Dev Dyn. 2007 Nov;236(11):3137-43

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory