About   Help   FAQ
Gal-TII-pA, Gal-TII-pB Primer Detail
Primers
  • Name
    Gal-TII-pA, Gal-TII-pB
  • Primer 1 Sequence
    TTGATTTCTAACTCTCATGCCTG
  • Primer 2 Sequence
    TCTTTGTATCAGCTCTGACACC
  • ID
    MGI:3772802
Genes
B3galt4 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Expression
  • Assay Results
    7
References
J:128836 Ngamukote S, et al., Developmental changes of glycosphingolipids and expression of glycogenes in mouse brains. J Neurochem. 2007 Dec;103(6):2327-41

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/04/2022
MGI 6.17
The Jackson Laboratory