About   Help   FAQ
D2Dcr68-pA, pB Primer Detail
Primers
  • Name
    D2Dcr68-pA, pB
  • Primer 1 Sequence
    CAGAAGAAAAAAATCCATAAGTGAACA
  • Primer 2 Sequence
    ACTTTTTTCAAACAGACAAACCAGTGT
  • ID
    MGI:3765521
  • Product Size
    120 bp
  • Other IDs
    507627 (NCBI UniSTS)
Genes
D2Dcr68 DNA Segment, Chr 2, Derry C. Roopenian 68
References
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:127014 Sproule TJ, et al., Mapping of primers in the mouse. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory