About   Help   FAQ
MH1186 probe 585 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MH1186 probe 585
  • Sequence Type
    cDNA
  • ID
    MGI:3724776
  • Note
    Probe was amplified by RT-PCR (see MGI:3724054 for primer sequences). Template sequence provided by GenePaint:
    TGTTGTGGGCAGTGGAATAGATGTGATGAGTAGAAGTAAAGAGGACTGTGTTCCAGTACC
    GCCGGACCACTCACAAGCTTCTTGCATTGAGCCTTCCACACATAAAACTCTGTTATGGGA
    TTCTTTTCAGAGGTTGAGTGGTATTGGTATATTACATGAAACTCTTCCAGAAGTTGGTCG
    CCTAAGTCTTAATAGTTCTACTAGTTCAGAGACTAGTTTTAATCTGGAACCAAAGAGTTA
    TGTGCACAGTGATGCTTTTGCAGATGATGTGGGAAAAGGACAAGCTATTCCAGAATTAGA
    TTCTAATTTACAGGCTCGTCTCACTAGTTATGAGGCTCTGAAGAAATCTCTTAGCAAAAT
    CAGGGAAGAATCTTACCTGTCTAATCCCAAGACACTTGAACAACACAAAGTAGAACTGAG
    CCCTGTAGCCAAAGCTGTGCAAGCAGATGATGCACACACTGTTTGGGACACTCAGGATTT
    GTTTATTGACTACGCAAAGCCATCTTCCCTCGTGCCACTTGATGGAAAAACACAGACTGT
    ATCACTAACTAAAGCTTTTCTGGTGGAGCAAAAATTGAAGACCACAGTACCATGTAGCCT
    TGGAGAATTTCTGCCTAGTTTAAAAGAAGAAGAAATCTCAAGTAAGAGCCTTGAAGCAAG
    AGACTCTCTGATTTGACAAGATGAAGCATTTTCAAGTTGATTTAGCTGTGATGCACTTAC
    CCTG
  • Synonyms
    GUDMAP:15322 probe, GUDMAP:15323 probe, maprobe:7640, MH_QG178, T50969
Source
  • Species
    mouse, laboratory
Genes
Haus6 HAUS augmin-like complex, subunit 6
Expression
  • Assay Results
    142
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:177549 Willnow T, et al., The European renal genome project: an integrated approach towards understanding the genetics of kidney development and disease. Organogenesis. 2005 Apr;2(2):42-7
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/09/2022
MGI 6.21
The Jackson Laboratory