About   Help   FAQ
MH917-pA, MH917-pB Primer Detail
Primers
  • Name
    MH917-pA, MH917-pB
  • Primer 1 Sequence
    GATCTGTGCCCAGTGTGAGA
  • Primer 2 Sequence
    TTCAGCTGCCCCATAGAAA
  • ID
    MGI:3723981
  • Synonyms
    T50989-pA, T50989-pB, T71069-pA, T71069-pB
Genes
Sfrp5 secreted frizzled-related sequence protein 5
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:146657 Witte F, et al., Comprehensive expression analysis of all Wnt genes and their major secreted antagonists during mouse limb development and cartilage differentiation. Gene Expr Patterns. 2009 Apr;9(4):215-23
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory