About   Help   FAQ
MH594-pA, MH594-pB Primer Detail
Primers
  • Name
    MH594-pA, MH594-pB
  • Primer 1 Sequence
    CCCTTTCCAGTCCTGGTGTA
  • Primer 2 Sequence
    AATCCAGTGGTGGGTGGATA
  • ID
    MGI:3723792
  • Synonyms
    T51209-pA, T51209-pB
Genes
Wnt3a wingless-type MMTV integration site family, member 3A
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory