About   Help   FAQ
Apoa1-pE, Apoa1-pF Primer Detail
Primers
  • Name
    Apoa1-pE, Apoa1-pF
  • Primer 1 Sequence
    GTGGCTCTGGTCTTCCTGAC
  • Primer 2 Sequence
    ACGGTTGAACCCAGAGTGTC
  • ID
    MGI:3711966
Genes
Apoa1 apolipoprotein A-I
Expression
  • Assay Results
    2
References
J:119141 Mandel S, et al., Activity-dependent neuroprotective protein (ADNP) differentially interacts with chromatin to regulate genes essential for embryogenesis. Dev Biol. 2007 Mar 15;303(2):814-24

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory